Blue2793 Blue2793
  • 02-10-2017
  • Biology
contestada

How are grasslands and deciduous forests alike?

Respuesta :

elismith0218
elismith0218 elismith0218
  • 03-10-2017
location, animals, rains, plants, and it can be cold

Answer Link

Otras preguntas

i have a couple questions:Write an equation and use it to solve the problem.1.solve The yukon River is 1,980 miles long, and twice as long as the platte river.
Colton finished his math homework at 8:27. He spent 32 minutes working on it. What time did Colton start his homework?
RIDDLE : I have cities, but no houses. I have mountains without trees. I have water but no fish. What Am I 50pts
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
What movie or book do you think best mirrors the French Revolution and its ending? Provide at least 3 examples from the movie or book that are similar to the Fr
How do people's agricultural practices affect the environment of sub-Saharan Africa? A. Many farmers practice slash-and-burn agriculture, leading to deforestati
Find the area of the circle below
Please help me please help me thank you
Ignore the thing i marked i dont know if its right.
answer for points(No need to do a explaination on how u got it)The variable of B stands for the (area of the base)(height)(length)(width)In this prism, B equals