princessvenicecom princessvenicecom

03-10-2021
English

contestada

what is a frigid A.very cold B.very cozy C.very hot D.very warm

Respuesta :

Аноним Аноним

03-10-2021

Answer:

very cold

Explanation:

Brainliest?

Answer Link

Otras preguntas

What type of grass grows naturally on the Great Plains?

Will mark BRAINLIEST. Molarity Please no Bs answers. Only going to be reported. If water is added to 145 mL of a 0.55 M KOH solution until the volume is 250 mL

Identify what the ancient Israelites believed about connecting with God.

During the 1800's the United States acquired huge amounts of land through several land acquisitions that stretched its border from the Atlantic Ocean to the Pac

I need help asssaaapppppp

In order to maintain a high level of performance, what types of foods do you think an athlete should eat right before a race? Select one.please helpfoods high i

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Do drone batteries discharge 100% of their total capacity?

Which area is dopamine released?

HELP PLS Ticks are parasitic insects that feed on blood. Consider a single population of ticks that divides into two populations. One population feeds on the b