thornlilly17 thornlilly17

01-02-2019
Mathematics

contestada

in a rectangle KLMN, KM = 6x + 16 and LN = 49. find the value of x

Respuesta :

lambuhere lambuhere

08-02-2019

Answer:

5.5

Step-by-step explanation:

in a rectangle, opp. sides are equal,

∴, KM=LN

∴, 6x+16=49

6x = 33

x = 5.5

Answer Link

manuelpillado56 manuelpillado56

28-01-2020

Answer:

5.5

Step-by-step explanation:

Answer Link

Otras preguntas

How does biodiversity affect sustainability after a catastrophic event in a particular biome or habitat?

What brought the Pilgrims to New England? A. riches B. religion C. trade D. landIf you have any questions leave a comment in the comment section and I will try

Can you answer these two questions?

Solve the following quadratic equation. A. x = 11 and x = 13 B. x = -11 and x = -13 C. x = -11 and x = 13 D. x = 11 and x = -13

Write a function in any form that would match the graph shown below. PLEASE HELP

3/5 x 7/9 multiplication

Suppose that a uniform rope of length L resting on a frictionless horizontal surface, is accelerated along the direction of its length by means of a force F, pu

if the volume is 120, the length is 6 and the height is 5 what is the width?

May someone help me with this please?

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-